Die Heuning Pot Literature Guide
© 2014 Shmoop University, Inc. All rights reserved.
 
DNA Structure, Replication, and Technology

DNA Structure, Replication, and Technology

Quizzes

DNA Structure, Replication, and Technology: Gene, Express Yourself Quiz

Think you’ve got your head wrapped around DNA Structure, Replication, and Technology? Put your knowledge to the test. Good luck — the Stickman is counting on you!
Time
0:00
Score my Quiz Win
0
Fail
0

WIN

0

FAIL

0
Q. We have identified a possible target for gene therapy to prevent X-linked severe combined immunodeficiency, a genetic disorder where the immune system does not function normally. This is commonly called "bubble boy" disease, as victims cannot fight any infection. Below is the sequence of DNA with the gene we want to target: [LINK] http://www.ncbi.nlm.nih.gov/nuccore/NC_000023.10?report=fasta&from=70327254&to=70331481&strand=true Which of the following primer pairs is the best to amplify the "bubble boy" gene?


5´-AGAGGAAACGTGTGGGTGG-3´ and 5´-TTTTTGATGATTATCAACAG-3´
5´-TCTCCTTTGCACACCCACC-3´ and 5´-AAAAACTACTAATAGTTGTC-3´
5´- TCTCCTTTGCACACCCACC -3´ and 5´-TTTTTGATGATTATCAACAG-3´
5´-AGAGGAAACGTGTGGGTGG-3´ and 5´- AAAAACTACTAATAGTTGTC -3´
5´-GGTGGGTGTGCAAAGGAGA-3´ and 5´- AAAAACTACTAATAGTTGTC -3´
Q. You can easily use the program [LINK] NEB Cutter to identify restriction sites in a sequence. Which of the following restriction enzymes do NOT have a cut site in the "bubble boy" gene?


NcoI (CCATGG)
SacI (GAGCTC)
StuI (AGGCCT)
EcoRI (GAATTC)
DraI (TTTAAA)
Q. Knowing what you know from the answer in the above question, with which of the following restriction enzymes should you digest to put the "bubble boy" gene into a plasmid?


SacI
NcoI
DraI
StuI
EcoRI
Q. Use [LINK] BLAT on the UCSC Genome Browser to identify the gene of interest. What is the name of the gene?


IL2RG
SOD1
NFKB
PVRL
MIRb
Q. Oops. You realize that you actually want to express the protein and NOT do gene replacement therapy. Which of the following would be the BEST way to do this?


Make a plasmid with the "bubble boy" gene.
Make a plasmid with the "bubble boy" cDNA.
Make an Agrobacterium with the "bubble boy" gene.
Make a retrovirus with the "bubble boy" gene.
Microinject the "bubble boy" cDNA into human embryos.
Q. Which of the following enzymes would be the MOST useful to making cDNA from mRNA?


NcoI
DNA polymerase
RNA polymerase
Reverse transcriptase
"Bubble boy" protein
Q. Which of the following processes uses codons to make amino acids?


DNA replication
Translation
Transcription
Reverse transcription
Mitosis
Q. Which of the following would NOT be described as an inheritable trait?


Eye color
Peapod color
Blood type
Seed shape
Muscle size
Q. Which of the following would BEST increase gene expression?


Activator protein binding DNA
DNA methylation
Histone methylation
Repressor protein binding DNA
Deacetylation of histones
Q. How many nucleotides form an anticodon?


1
2
3
4
5
back to top