© 2014 Shmoop University, Inc. All rights reserved.
 

Topics in Depth

The Theme of Test Your Knowledge! in DNA Structure, Replication, and Technology

The Genetic Code Questions

1. Which of the following is not a polymer?

(A) DNA
(B) Adenine
(C) Protein
(D) RNA
(E) Plastic

2. Which of the following bases normally pairs with guanine?

(A) Adenine
(B) Thymine
(C) Cytosine
(D) Purine
(E) Pyrimidine

3. Which of the following is DNA?

(A)
(B)
(C)
(D) All three are DNA.
(E) None of the above are DNA.

4. Which would be a complementary RNA sequence to 5´-AGATCATCGAGTTGTCGAGGGT-3'?

(A) 5´-TCTAGTAGCTCAACAGCTCCCA-3´
(B) 5´-UGGGAGCUGUUGAGCUACUAGA-3´
(C) 5´-ACCCTCGACAACTCGATGATCT-3´
(D) 5´-TGGGAGCTGTTGAGCTACTAGA-3´
(E) 5´-ACCCUCGACAACUCGAUGAUCU-3´

5. Which of the following would be the complementary DNA sequence to 5´-AGATCATCGAGTTGTCGAGGGT-3'?

(A) 5´-TCTAGTAGCTCAACAGCTCCCA-3´
(B) 5´-UGGGAGCUGUUGAGCUACUAGA-3´
(C) 5´-ACCCTCGACAACTCGATGATCT-3´
(D) 5´-TGGGAGCTGTTGAGCTACTAGA-3´
(E) 5´-ACCCUCGACAACUCGAUGAUCU-3´

DNA Packaging Questions

1. Which of the following will lead to the greatest enhancing of gene expression?

(A) Demethylation of histones
(B) Methylation of histones
(C) Acetylation of histones
(D) Deacetylation of histones
(E) Methylation of DNA

2. Rank the following in size from the largest to the smallest.

(A) Adenine
(B) Sex chromosome
(C) A nucleosome
(D) Histone
(E) Chromatin

3. Which of the following amino acids is MOST important for regulating the function of histones?

(A) Asparagine
(B) Tryptophan
(C) Cysteine
(D) Lysine
(E) Serine

4. Which of the following is NOT a core histone?

(A) H1
(B) H2A
(C) H2B
(D) H3
(E) H4

5. What physical force is MOST responsible for histones' ability to bind DNA?

(A) Gravity
(B) Charge interactions between histones and DNA
(C) Hydrogen bonding between histone cores and DNA
(D) Centrifugal forces winding DNA
(E) Van der Waals forces

From Genes to Proteins Questions

Use the codon table below to determine what the following sequences encode. An asterisk (*) means "stop codon."

1. Gene Sequence – 5´-GGGCATCAGCCACAATGG-3´

(A) GHQPQW
(B) PLWLMP
(C) PMLWLP
(D) WQPQHG
(E) GISHNP

2. mRNA Sequence – 5´-CAUGUGUAUCCGGAACCC-3´

(A) GFRIHM
(B) MHIRFG
(C) HVYPEP
(D) PEPYVH
(E) GSGYTC

3. DNA template for mRNA – 5´-CCGAGATTAGGCCTCAGA-3´

(A) PRLGLR
(B) RLGLRP
(C) RS*LIS
(D) SEA*SR
(E) EIRPQF

4. Reverse complement of RNA – 5´- CGTGGTCACCGGTCAGCTCGG-3´

(A) RGHRSAR
(B) VVTGQLL
(C) WSPVSSQ
(D) PS*PVTT
(E) ELTGDHA

5. Gene reverse complement sequence – 5´-CAATGCCGGATTGAC-3´

(A) QCRID
(B) VNPAL
(C) DIRCQ
(D) LAPNV
(E) SIRHL

DNA Replication Questions

We will show you various cells in different phases of the cell cycle. You should name what phase (G1, S, G2, Mitosis-Prophase, Metaphase, Anaphase, Telophase, Cytokinesis) is shown.

1. The following picture describes which stage of the cell cycle?

(A) S Phase (Interphase)
(B) Metaphase
(C) Telophase
(D) Prophase
(E) G2 Phase

2. The following picture describes which stage of the cell cycle?

(A) S Phase (Interphase)
(B) Metaphase
(C) Telophase
(D) Prophase
(E) G2 Phase

3. The following picture describes which stage of the cell cycle?

(A) S Phase (Interphase)
(B) Metaphase
(C) Telophase
(D) Prophase
(E) G2 Phase

4. Which of the following is common between DNA replication and RNA transcription?

(A) Starts from a DNA template
(B) Produces an nucleotide product
(C) Uses a polymerase enzyme
(D) Can use either strand of DNA as a template
(E) All of the above are true

5. Which of the following is LEAST important for bacterial DNA replication?

(A) RNA primer
(B) Origin of replication sequence
(C) DNA polymerase
(D) Okazaki fragments
(E) Telomerase

Polymerase Chain Reaction Questions

1. Which of the following is NOT a PCR step?

(A) Extension at 72° C.
(B) Primer Annealing
(C) Denaturation
(D) All are PCR steps
(E) None are PCR steps

2. Based upon this sequencing gel, what is the sequence of nucleotides?

(A) GCAATAGAAGTTCCAATA
(B) TATTGGAACTTCTATTGC
(C) CGTTATCTTCAAGGTTAT
(D) ATAACCTTGAAGATAACG
(E) How am I supposed to know that?

3. Which is not an ingredient in PCR?

(A) RNA
(B) DNA
(C) Polymerase
(D) ATP
(E) Primers

4. Which of the following is NOT true about plasmids?

(A) They are small pieces of DNA
(B) They help the bacteria survive in adverse conditions
(C) They are useful for biotechnology
(D) They can make mRNA transcripts
(E) They are single stranded

5. Given the gene sequence below, which would be the correct pair of primers to amplify the sequence.


(A) 5´AAGTTCTTCTCCTTTACTCAT, 5´TTCAAGAAGAGGAAATGAGTA
(B) 5´ AAGTTCTTCTCCTTTACTCAT, 5´ATGAGTAAAGGAGAAGAACTT
(C) 5´ATGAGTAAAGGAGAAGAACTT, 5´AATAAACATATCAAGTAGGTA
(D) 5´TTATTTGTATAGTTCATCCAT, 5´ATGAGTAAAGGAGAAGAACTT
(E) 5´AATAAACATATCAAGTAGGTA, 5´TTCAAGAAGAGGAAATGAGTA

Genomes Questions

1. Which of the following is true?

(A) Genomes are about 1 million kilobases in length
(B) Bigger organisms have bigger genomes
(C) Genomes are in the nucleus
(D) Genomes are composed of 99% genetic information
(E) Genomes encode all the genetic sequences of an organism

2. Which of the following would NOT be considered as junk DNA?

(A) Introns
(B) cDNA
(C) Enhancer sequences
(D) Exons
(E) None are junk DNA

3.

Given the above phylogenetic tree, which of the following pair of taxa have the closest evolutionary relationship?

(A) A and B
(B) D and C
(C) E and B
(D) B and C
(E) A and D

4. What is the hypothetical ancestor of taxa A and C?

(A) C
(B) F
(C) G
(D) H
(E) I

5. Which of the following is not a living taxa?

(A) C
(B) I
(C) D
(D) E
(E) A

Recombinant DNA Questions

1. Which of the following is LEAST important to have on a plasmid?

(A) Origin of replication sequence
(B) Antibiotic resistence gene
(C) T7 promoter
(D) Multiple cloning site
(E) Ribosome binding site

2. DraI is a restriction enzyme that cuts at the sequence TTTAAA. How many times will DraI cut the following sequence?

>gi|211909964:4419-5135 Neisseria gonorrhoeae plasmid pCmGFP, complete sequence ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA

(A) 1
(B) 3
(C) 6
(D) 0
(E) 4

3. Which of the following are most useful to deliver DNA to plants?

(A) Retroviruses
(B) Adenoviruses
(C) Agrobacterium
(D) Microinjection
(E) Osmosis

4, If you wanted to make a plasmid containing a gene that is 150 kb in length, which of the following would you use?

(A) Genetic sequence of protein
(B) cDNA of protein
(C) Retrovirus vector
(D) Agrobacterium
(E) Microinjection

5. You want to express a protein in bacteria that would be transferred to humans orally. Which of the following would you need to use?

(A) Genetic sequence of protein
(B) cDNA of protein
(C) Retrovirus vector
(D) Agrobacterium
(E) Microinjection

The Genetic Code Answers

1. The correct answer is (B).
2. The correct answer is (C).
3. The correct answer is (C).
4. The correct answer is (E).
5. The correct answer is (C).

DNA Packing Answers

1. The correct answer is (C).
2. The correct answer is (B), then (E), then (C), then (D), and finally, (A).
3. The correct answer is (D).
4. The correct answer is (A).
5. The correct answer is (B).

From Genes to Proteins Answers

1. The correct answer is (A).
2. The correct answer is (C).
3. The correct answer is (D).
4. The correct answer is (D).
5. The correct answer is (B).

DNA Replication Answers

1. The correct answer is (C).
2. The correct answer is (B).
3. The correct answer is (D).
4. The correct answer is ( ).
5. The correct answer is (E).

Polymerase Chain Reaction Answers

1. The correct answer is (D).
2. The correct answer is (B).
3. The correct answer is (A).
4. The correct answer is (E).
5. The correct answer is (D).

Genomes Answers

1. The correct answer is (E).
2. The correct answer is (D).
3. The correct answer is (A).
4. The correct answer is (C).
5. The correct answer is (B).

Recombinant DNA Answers

1. The correct answer is (E).
2. The correct answer is (A).
3. The correct answer is (C).
4. The correct answer is (B).
5. The correct answer is (B).

We’re adding new materials and resources all the time.

Sign up for our newsletter to stay up to date.

An informed Shmooper is the greatest weapon against pop quizzees.

Advertisement
Advertisement
back to top